Skip to main content

Table 1 Primes used to confirm the variants in ABC transporter genes

From: Whole-exome sequencing identifies novel mutations in ABC transporter genes associated with intrahepatic cholestasis of pregnancy disease: a case-control study

Order Gene Patient Annealing temperature (°C) Amplicon (bp) Forward primer (5′-3′) Reverse primer (5′-3′)
1 ABCA2 ICP64 56 229 CTACCCAGGTCCATCCTGAC CCACCCACTTGTCCATCTCT
2 ABCA10 ICP35 56 158 AACCTATGCTCGCTGGTTTG TGTTCTTACCTGGGCCATTC
3 ABCA12 ICP75 56 150 CATGGATCCGAAGTCGAAA ACCTTTTCCCACCTGTCATC
4 ABCA13 ICP112 56 245 CAAGGACCAAGCATCATTCC GGGAGGTGGAAGCAGAAGAT
5 ABCB4 ICP133, ICP135 50 200 ACATTCCAGGTCCTATTT TCGAGAAGGGTAAGAAAA
6 ABCB4 ICP154 56 463 CTGTCAAAGAGGCCAACG GCTTCTGCCCACCACTCA
7 ABCB5 ICP47 56 460 TCTTACACTAGCCATCCT CTATTTCCACGACTTACA
8 ABCB11 ICP2 56 205 GCTATCGCCAGAGCCCTCA TACTCCCATCCCTCCCACC
9 ABCC2 ICP79 56 368 CCTCTTACCTCCTGTGAC GTAGACCGTGGAATTGAC
10 ABCC3 ICP93 56 189 CCCCAAACTCCTTCTCCC TGGCATCCACCTTAGTATCA
11 ABCC9 ICP124 56 166 TCCCACAACCCATTCATCTT GCCTCTGCCAACTTTGTAGC
12 ABCG1 ICP113 56 212 CTCACGGTGCCTCTTGACTT GGTGTCATTCAGGCTGACCT
13 ABCG2 ICP6 56 180 GTGGCCTTGGCTTGTATGAT GATGGCAAGGGAACAGAAAA
\