Skip to main content

Table 1 Real-time PCR primer sequence

From: High miR-200a-3p expression has high diagnostic values for hypertensive disorders complicating pregnancy and predicts adverse pregnancy outcomes

Gene Forward 5’-3’ Reverse 5’-3’
miR-200a-3p CGCGTGTAGCAATGGTCTGT AGTGCAGGGTCCGAGGTATT
U6 CTCGCATCGGCAGCACA AACGCTACTCGAATTGCGT