Skip to main content

Table 2 Primer sequences and amplified fragment list

From: Effects of an orally supplemented probiotic on the autophagy protein LC3 and Beclin1 in placentas undergoing spontaneous delivery during normal pregnancy

NameForward primerReverse primerFragment size
LC35′-GAGAGCAGCATCCAACCAAA-3′5′-ACATGGTCAGGTACAAGGAAC-3′103 bp
Beclin15′-CGAGGGATGGAAGGGTCTAAG-3′5′- GTTCCTGGATGGTGACACGG-3′130 bp
β-actin5′- GCATGGGTCAGAAGGATTCCT-3′5′- TCGTCCCAGTTGGTGACGAT −3′106 bp