Skip to main content

Table 2 Oligonucleotide primers of melting curve-based multiplex real-time PCR

From: Development of a melting-curve based multiplex real-time PCR assay for simultaneous detection of Streptococcus agalactiae and genes encoding resistance to macrolides and lincosamides

Targeta Nucleotide sequence (5′ to 3′) Amplicon size (bp) Reference
erm(A)/(TR) F: CCGGCAAGGAGAAGGTTATAATGA 190 Otaguiri et al. [5]
erm(B) F: GCTCTTGCACACTCAAGTCTCGAT 117 Otaguiri et al. [5]
mef(A/E) F: GCGATGGTCTTGTCTATGGCTTCA 225 Otaguiri et al. [5]
  1. acfb gene encodes the CAMP factor; erm genes encode 23S rRNA methylases; mef gene encodes efflux pumps; RNaseP gene encodes human ribonuclease P; IGS1, intergenic spacer 1 of ribosomal RNA gene cluster of Cryptococcus gattii. bThe nucleotide sequences of Streptococcus agalactiae genes deposited in the GenBank/EMBL databases were used for specific primer design