Skip to main content

Table 1 Sequences of primers used to measure gene expression of GPX 1(1) and YWHAZ in retained and non-retained placenta and applicon sizes for GPX1(1), YWHAZ, NF-κB and IκBα mRNA

From: Oxidative stress and inflammation in retained placenta: a pilot study of protein and gene expression of GPX1 and NFκB

Gene Primer Applicon size
GPX1(1) F: 5′ TTCCCGTGCAACCAGTTT 3′ 63
R:5′AACGAAGAGATTCTGAATTCCCTC 3′
YWHAZ F:5′GCAATTACTGAGAGACAACTTGACA3′ 96
R: 5′ TGGAAGGCCGGTTAATTTT 3′
NFKB PrimePCR SYBR Green Assay: NFKBAa 76
NFKBIA PrimePCR SYBR Green Assay: NFKBIAa 64
  1. aspecific primer sequence not divulged by manufacturer (Bio-Rad Laboratories Inc., USA)