Skip to main content

Table 1 Primer sequences

From: Development and validation of primary human myometrial cell culture models to study pregnancy and labour

Name Primer Sequences (5’ – 3’) Product Size Conventional Or real-time Target Gene (GenBank Accession)
β2-microglobulin F: CTTATGCACGCTTAACTATCTTAACAA
R: TAGGAGGGCTGGCAACTTAG
127bp
Real-time
B2M
NM_004048
Calponin F: GATGGCATCATTCTTTGCGA
R: TTGTAGTAGTTGTGTGCGTG
F: CTGAGAGAGTGGATCGAGGG
R: TGATCTTCTTCACGGAGCCT
701bp
Conventional
127bp
Real-time
CNN1
NM_001299
Connexin 43 F: GTGCCTGAACTTGCCTTTTC
R: GATGATGTAGGTTCGCAGCA
F: GGAGTTCAATCACTTGGCGT
R: ACACCTTCCCTCCAGCAGTT
522bp
Conventional
134bp Real-time
GJA1
NM_000165
Cyclo-oxygenase-type 2 also known as Prostaglandin GH synthase-2 F: AGATCATCTCTGCCTGAGTATCTT
R: TTCAAATGAGATTGTGGAAAAATTGCT
F: GCTGGGCCATGGGGTGGACT
R: CCTGCCCCACAGCAAACCGT
305bp
Conventional
200bp
Real-time
COX-2 or PTGS-2
NM_000963
Glyceraldehyde-phosphatedehydroegnase F: CCACCCATGGCAAATTCCATGGCA
R: TCTAGACGGCAGGTCAGGTCCACC
598bp
Conventional
GAPDH
NM_002046
Vimentin F: TCAGAGAGAGGAAGCCGAAA
R: GTGAGGGACTGCACCTGTCT
F: GGCTCAGATTCAGGAACAGCATG
R: CCTGTCTCCGGTACTCAGTGGAC
380bp
Conventional
230bp
Real-time
VIM
NM_003380
  1. Sequence of primers used for conventional and real-time RT-PCR analysis.